View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_low_73 (Length: 214)
Name: NF16975_low_73
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_low_73 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 14 - 198
Target Start/End: Original strand, 43174685 - 43174869
Alignment:
| Q |
14 |
aatatcttcttgctgtcaatttatttgaaaattttaccacttacggttaagctaattttggggaacgtgacacgcaatttcaagtggaaactactagcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43174685 |
aatatcttcttgctgtcaatttatttgaaaattttaccacttacggttaagctaattttggggaacgtgacacgcaatttcaagtggaaactactagcaa |
43174784 |
T |
|
| Q |
114 |
gaaatgtagcctatgctaaagtaatgttttcattgtctctccctaaaagaaaaagggatgaagagatgagagcgagtgaccatag |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43174785 |
gaaatgtagcctatgctaaagtaatgttttcattgtctctccctaaaagaaaaagggatgaagagatgagagcgagtgaccatag |
43174869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 98 - 185
Target Start/End: Original strand, 43166156 - 43166243
Alignment:
| Q |
98 |
tggaaactactagcaagaaatgtagcctatgctaaagtaatgttttcattgtctctccctaaaagaaaaagggatgaagagatgagag |
185 |
Q |
| |
|
||||||||||||||||| || || || | ||||||||||||||||| ||||||||||| || |||||||| |||||||| ||||||| |
|
|
| T |
43166156 |
tggaaactactagcaaggaaggtggcatcagctaaagtaatgttttccttgtctctcccaaagagaaaaagagatgaagaaatgagag |
43166243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University