View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16975_low_76 (Length: 206)
Name: NF16975_low_76
Description: NF16975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16975_low_76 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-106
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 41468414 - 41468209
Alignment:
| Q |
1 |
agaagattaagagagaatttatgctctatgtagctcagtggagaaacatgacatctaatctccatgcccttggcccttgtatctctcatgaacataataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41468414 |
agaagattaagagagaatttatgctctatgtagctcagtggagaaacatgacatctaatctccatgcccttggcccttgtatctctgatgaacataataa |
41468315 |
T |
 |
| Q |
101 |
caagttgatcgtgccctccacaaaagagaagttcagaatggccatctttgacatgcatcctgaaaaatatcgatttataaactactaaaacccatatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
41468314 |
caagttgatcgtgccctccacaaaagagaagttcagaatggccatctttgacatgcatcctgaaaaatatcgatttataaacaactaaaactcatatttt |
41468215 |
T |
 |
| Q |
201 |
aaaatc |
206 |
Q |
| |
|
|||||| |
|
|
| T |
41468214 |
aaaatc |
41468209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University