View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16976_high_33 (Length: 262)
Name: NF16976_high_33
Description: NF16976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16976_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 31 - 243
Target Start/End: Complemental strand, 21132620 - 21132406
Alignment:
| Q |
31 |
gtaatgttaaaattcatgcaaattatacaatatttatatgccgtcttgcatagagaaatgataattgatgcaaattttagagtattctagattattttag |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21132620 |
gtaatgttaaaattcatgcaaattatacaatatttatatgccgtcttgcatagagaaatgataattgatgcaaattttagagtattctagattattttag |
21132521 |
T |
 |
| Q |
131 |
--tctttggagtagaaatcttcaacacctatagatagacaatacatatgttattgacatggtggatgaggtagtgttcactctatattccaccactaatc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21132520 |
agtctttggagtagaaatcttcaacacctatagatagacaatacatatgttattgacatggtggatgaggtagtgttcactctatattccaccactaatc |
21132421 |
T |
 |
| Q |
229 |
attgtatggtccata |
243 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
21132420 |
attgtatggtccata |
21132406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 15 - 54
Target Start/End: Complemental strand, 18661741 - 18661702
Alignment:
| Q |
15 |
aacctgtgaatggtacgtaatgttaaaattcatgcaaatt |
54 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
18661741 |
aacctgtaaacggtacgtaatgttaaaattcatgcaaatt |
18661702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University