View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16976_high_37 (Length: 249)
Name: NF16976_high_37
Description: NF16976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16976_high_37 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 243741 - 243989
Alignment:
| Q |
1 |
tgcagggagagatgaagttgatatgcttgagattgctggcttgattagccctcacttccttaattgaaggcaaggtttagtttttatatcaaggccacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
243741 |
tgcagggagagatgaagttgatatgcttgagattgctggcttgattagccctcacttccttaattgaaggcaaggtttagtttttatatcaaggccacat |
243840 |
T |
 |
| Q |
101 |
tttggtgtatggaactgttatatttggaagtatgtgtcctgcaactgcaacatagtagtagccttagnnnnnnnnnnnngttagtactttgggtacagaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
243841 |
tttggtgtatggaactgttatatttggaagtatgtgtcctgcaactgcaacatagtagtagccttagttttttgtttttgttagtactttgggtacagaa |
243940 |
T |
 |
| Q |
201 |
caagattctgttgaagatttcgttttgaatcatgtatattcttcgacat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
243941 |
caagattctgttgaagatttcgttttgaatcatgtaatttcttcaacat |
243989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 75 - 130
Target Start/End: Complemental strand, 21206182 - 21206127
Alignment:
| Q |
75 |
gtttagtttttatatcaaggccacattttggtgtatggaactgttatatttggaag |
130 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21206182 |
gtttagtttttatatgaaggccacattttggtgtatggaactattatatttggaag |
21206127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 21210555 - 21210518
Alignment:
| Q |
1 |
tgcagggagagatgaagttgatatgcttgagattgctg |
38 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
21210555 |
tgcagggagagatgaatttggtatgcttgagattgctg |
21210518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University