View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16976_high_47 (Length: 221)
Name: NF16976_high_47
Description: NF16976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16976_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 17 - 207
Target Start/End: Original strand, 40011672 - 40011862
Alignment:
| Q |
17 |
agaggagacaaacttaagagggagagtttgattgagttgaaggaaatgtttcgtgagagaaaaatggatgaattgaaatgggtttttgaggattatattg |
116 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40011672 |
agaggagagaaacttaagagggagagtttgattgagttgaaggaaatgtttcgtgagagaaaaatggatgaattgaaatgggtttttgaggatgatattg |
40011771 |
T |
 |
| Q |
117 |
aaattaacaaggtttggttcgatgaaaataacaatgggaaaaggaaaaagacgagtaagcgaagtgaggttcaggttgtgaggtttcttgt |
207 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40011772 |
aaattaacgaggtttggttcgatgaaaataacaatgggaaaaggaaaaagacgagtaagcgaagtgaggttcaggttgtgaggtttcttgt |
40011862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University