View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16976_low_12 (Length: 416)
Name: NF16976_low_12
Description: NF16976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16976_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 16374500 - 16374712
Alignment:
| Q |
1 |
tgtgcgtgtatgagagagagtttttaaaacttagaagccgtataaaaatatatagtgtttgtgcacatatttgtgtgagaaaatcatttctcaataagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16374500 |
tgtgcgtgtatgagagagagtttttaaaacttagaatccgtataaa--tatacagtgtttgtgcacatatttgtgtgagaaaatcatttctcaataagta |
16374597 |
T |
 |
| Q |
101 |
aaagtatatgctgaaattttaacatgagatattcatatatacttcctactgaatcatattatttgtcattgtttttggtttcaactgggagagcagtggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16374598 |
aaagtatatgctgaaattttaacatgagatattcatatatacttcctactgaatcatattatttgtcattgtttttggtttcaactgggagagcagtggt |
16374697 |
T |
 |
| Q |
201 |
ataattctttgcgaa |
215 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
16374698 |
ataattcttcgcgaa |
16374712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 239 - 403
Target Start/End: Complemental strand, 16369289 - 16369125
Alignment:
| Q |
239 |
gagtcaaagaaggcatattttgagcaaatggaagaaattcttgtgaggttggaagatgtgatcaacaaatacagtgaaggaaatgtcttttttggaggag |
338 |
Q |
| |
|
|||||||||||| | |||||||| || | | |||| | ||| ||| |||||||||||| | ||||| ||||| |||||| | |||||||||||||| |
|
|
| T |
16369289 |
gagtcaaagaagaaacattttgaggaactagcagaagtgcttttgaagttggaagatgtattgaacaagagcagtggaggaaaggacttttttggaggag |
16369190 |
T |
 |
| Q |
339 |
agaaaattggatttcttgatattgcttttgggtgctatttgaattggttgagggtcacagagaaa |
403 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||| |||||||||||| | ||||||| |
|
|
| T |
16369189 |
agaaaattggatttgttgatattgcttttggatgctatttgagttggttgagggttaaagagaaa |
16369125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University