View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16976_low_35 (Length: 251)
Name: NF16976_low_35
Description: NF16976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16976_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 13 - 236
Target Start/End: Complemental strand, 37805543 - 37805309
Alignment:
| Q |
13 |
aagaatatgtgtgtgtgagtgtgcgtgacacagaaatatgcaagcgtgaaaaaatagggtgagagaaatatttacattttgcatcacaagggcaatggga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37805543 |
aagaatatgtgtgtgtgagtgtgcgtgacacagaaatatgcaagcgtgaaagaatagggtgagagaaatatttacattttgcatcacaagggcaatggga |
37805444 |
T |
 |
| Q |
113 |
agcatgagaagaaaggtgcaaagaaaattagccatggtacaattggtgaggtaaaggag-----------nnnnnnnnnncttctttctgtagaggagct |
201 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37805443 |
agtatgagaagaaaggtgcaaagaaaattagccatggtacaattggtgaggtaaaggagttttttttttttttttttttctttctttctgtagaggagct |
37805344 |
T |
 |
| Q |
202 |
gtggaggttaaggagttataatataggcaaataat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37805343 |
gtggaggttaaggagttataatataggcaaataat |
37805309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University