View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16976_low_39 (Length: 242)
Name: NF16976_low_39
Description: NF16976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16976_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 63 - 228
Target Start/End: Complemental strand, 32707368 - 32707197
Alignment:
| Q |
63 |
acgttcacttggaatgaagcagatgaggttgtcactgatgagttggctgaagagtgatttgatggattcttcttagctcagtgattttccagaactcatt |
162 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32707368 |
acgttcacttggactgaagcagatgaggttgtcactgatgagttggctgaagagtgatttgatggattcttcttagctcagtgattttccagaactcatt |
32707269 |
T |
 |
| Q |
163 |
gtgaatcaaaacatacaatgattcaaggtt------acttgttaatttaatcaaagaaacaagttaaagagt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32707268 |
gtgaatcaaaacatacaatgattcaaggttgataacacttgttaatttaatcaaagaaacaagttaaagagt |
32707197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 41
Target Start/End: Complemental strand, 32707715 - 32707678
Alignment:
| Q |
4 |
agaaaccaagtgtaaagtgtaaacgcggtggtatattt |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32707715 |
agaaaccaagtgtaaagtgtaaacgcggtggtatattt |
32707678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University