View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16978_high_11 (Length: 325)
Name: NF16978_high_11
Description: NF16978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16978_high_11 |
 |  |
|
| [»] scaffold0300 (5 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0300 (Bit Score: 101; Significance: 5e-50; HSPs: 5)
Name: scaffold0300
Description:
Target: scaffold0300; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 194 - 314
Target Start/End: Complemental strand, 2342 - 2222
Alignment:
| Q |
194 |
aatagggattcttcttttctcattgtaaaggtctttatgggatcttcgatattattgtggagaaaaattagacccatgataaaccaacactagcatattt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| | ||||||||||| ||||||||||||||||| |
|
|
| T |
2342 |
aatagggattcttcttttctcattgtaaaggtctttatgggatcttcaatattattgtggaggaaaatcaaacccatgataagccaacactagcatattt |
2243 |
T |
 |
| Q |
294 |
gatagagtcgtttttgagaat |
314 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
2242 |
gatagagtcgtttttgagaat |
2222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0300; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 194 - 314
Target Start/End: Original strand, 950 - 1070
Alignment:
| Q |
194 |
aatagggattcttcttttctcattgtaaaggtctttatgggatcttcgatattattgtggagaaaaattagacccatgataaaccaacactagcatattt |
293 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
950 |
aatagggattcttcttttctcatagtaaaggtctttatgggatcttcgatattattgtggaggaaaatcaaacccatgataagccaacactagcatattc |
1049 |
T |
 |
| Q |
294 |
gatagagtcgtttttgagaat |
314 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
1050 |
gatagagttgtttttgagaat |
1070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0300; HSP #3
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 2519 - 2391
Alignment:
| Q |
1 |
aatttgaaagaaattaactcatatgcttggggtgctgagatgttggcatatttgtatcaaggtatgaaggattggaagaaaaggggtaagtcattagacg |
100 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||| |||| ||||||||||||| |||||||||||||||| ||||| ||||||| ||||||||||||||||| |
|
|
| T |
2519 |
aatttggaagaagttaactcatatgcttggggagctgcgatgttggcatatctgtatcaaggtatgaaagattgaaagaaaaagggtaagtcattagacg |
2420 |
T |
 |
| Q |
101 |
gcttcacctgacttataatggtaagagca |
129 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
2419 |
gcttcacctggcttataatggtaagagca |
2391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0300; HSP #4
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 441 - 522
Alignment:
| Q |
1 |
aatttgaaagaaattaactcatatgcttggggtgctgagatgttggcatatttgtatcaaggtatgaaggattggaagaaaa |
82 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||| |||| |||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
441 |
aatttggaagaagttaactcttatgcttggggagctgcgatgttggaatatctgtatcaaggtatgaaggattggaagaaaa |
522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0300; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 86 - 129
Target Start/End: Original strand, 838 - 881
Alignment:
| Q |
86 |
gtaagtcattagacggcttcacctgacttataatggtaagagca |
129 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
838 |
gtaagtcattggacggcttcacctgacttataatggtaagagca |
881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University