View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16978_high_21 (Length: 230)
Name: NF16978_high_21
Description: NF16978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16978_high_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 15 - 212
Target Start/End: Complemental strand, 30912414 - 30912217
Alignment:
| Q |
15 |
agagataagacgtgtatatgtcatccaactataaatttttcacctgcaaaaatcgatttgctatctagccgttggcttcgttagaaatcaattttgagct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30912414 |
agagataagacgtgtatatgtcatccaactataaatttttcacctgcaaaaatcgatttgctatctagctgttggcttcgttagaaatcaattttgagct |
30912315 |
T |
|
| Q |
115 |
gttggaattgatttcgtttcaaccaccaaaacttgggagaatagaaaaatcaggtatggtctattttaacgcaaattaaacagtttcaatgcgtaacc |
212 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30912314 |
gttggaattgatttcgcttcaaccaccaaaacttgggagaatagaaaaatcaggtatggtctattttaacgcaaattaaacagtttcaatgcgtaacc |
30912217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University