View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16978_low_24 (Length: 224)
Name: NF16978_low_24
Description: NF16978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16978_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 27780292 - 27780081
Alignment:
| Q |
1 |
ttatagttcagagaagaaatgaagagaagtataaattttaatatgactccttcgaactgaaggtaaggttatttgaagaatgaacttggcacatcaacag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27780292 |
ttatagttcagagaagaaatgaagagaagtataaattttaatatgactccttcgaactgaaggtaaggttatttgaagaatgaacttggcacatcaacag |
27780193 |
T |
 |
| Q |
101 |
agtcacttgtatcaatgtcgatgattagaatctcaagattagaagcaccaaaacgacatgaaaacacatcaattagctggtttttacatagaaactattt |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27780192 |
agtcacttgtatcaatatcgatgattagaatctcaagattagaagcatcaaaacgatatgaaaacacatcaattagctggtttttacatagaaactattt |
27780093 |
T |
 |
| Q |
201 |
aaatttcttctc |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
27780092 |
aaatttcttctc |
27780081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University