View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16979_low_17 (Length: 220)

Name: NF16979_low_17
Description: NF16979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16979_low_17
NF16979_low_17
[»] chr4 (1 HSPs)
chr4 (17-203)||(44228217-44228403)


Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 44228403 - 44228217
Alignment:
17 aagggttgcaaggatggattggacgatgatgtccacgtgtcgtcgtcaccggtggggaaacagagcaaacgtgaaatggagaaagtggggacgaggcgta 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44228403 aagggttgcaaggatggattggacgatgatgtccacgtgtcgtcgtcaccggtggggaaacagagcaaacgtgaaatggagaaagtggggacgaggcgta 44228304  T
117 gaggtggagaggatgacgtgttgattcatcaagacagtgattcggagtcgccgtcaaacagtcctatcagtcctaatagtagtgtgt 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44228303 gaggtggagaggatgacgtgttgattcatcaagacagtgattcggagtcgccgtcaaacagtcctatcagtcctaatagtagtgtgt 44228217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University