View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16979_low_8 (Length: 379)
Name: NF16979_low_8
Description: NF16979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16979_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 363
Target Start/End: Original strand, 26856234 - 26856596
Alignment:
| Q |
1 |
tgtggattaatagaaaaacaccagaaggagaagaagtggatcaatcttttgttgttgctattattttaggggtttttgtgatggcatttataactgacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26856234 |
tgtggattaatagaaaaacaccagaaggacaagaagtggatcaatcttttgttgttgctattattttaggggtttttgtgatggcatttataactgacat |
26856333 |
T |
|
| Q |
101 |
gtttggtatagcaattgttaatggatctttctggttagggttggttactcctgatggacctcgtttaggagcaacaatggtacaaaagaccaagactatt |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| || |||||||| || |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26856334 |
gtttggtatagcaattgttaatgggtctttctggttgggtttggttacaccggatggacctcgtttaggaacaacaatggtacaaaagaccaagactatt |
26856433 |
T |
|
| Q |
201 |
atgaatgagtttcttatgccattttcattcattatggtgggacaatattttgatttgtttgcattgggggcttctgattggaaaactttgcaacctttgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26856434 |
atgaatgagtttcttatgccattttcattcattatggtgggacaatattttgatttttttgcattgggggcttctgattggaaaagtttgcaacctttgt |
26856533 |
T |
|
| Q |
301 |
ttctcttgattttgactggatactcaaccaaattctttgttacttggttggctacaatgtatt |
363 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26856534 |
ttctcttgattttgactggatactcatccaaattctttgttacttggttggctgcaatgtatt |
26856596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University