View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1697_low_4 (Length: 344)
Name: NF1697_low_4
Description: NF1697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1697_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 18 - 333
Target Start/End: Complemental strand, 38429116 - 38428801
Alignment:
| Q |
18 |
gctaccaagtacacgacaagctatttgtctagccgaataaaatttcagcttctcttcagaatcagctaaagccttataagttgcacggtgcttcttatct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38429116 |
gctaccaagtacacgacaagctatttgtctagccgaataaaatttcagcttctcttcagaatcagctaaagccttataagttgcacggtgcttcttatct |
38429017 |
T |
 |
| Q |
118 |
tcctgctgtccaaaattcccctaaaaatccacaaaatcaatcacatcacacgcaaaacaatatcaacaacaccaacattactcacttgtaactttccacc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38429016 |
tcctgctgtccaaaattcccctaaaaatccacaaaatcaatcacatcacacacaaaacaatatcaacaacaccaacattactcacttgtaactttccacc |
38428917 |
T |
 |
| Q |
218 |
ggcgcggccaaatttcatctgagaatcgaaatctttctcaagaagcttcaaatcttcagcgatttgggtgaccatagctgggacaggtgaagtggtgccc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38428916 |
ggcgcggccaaatttcatctgagaatcgaaatctttctcaagaagcttcaaatcttcagcgatttgggtgaccatagctgggacaggtgaagtggtgccc |
38428817 |
T |
 |
| Q |
318 |
caaccttgccattctt |
333 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
38428816 |
cacccttgccattctt |
38428801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University