View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1698-Insertion-6 (Length: 91)
Name: NF1698-Insertion-6
Description: NF1698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1698-Insertion-6 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 2e-40; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 43596454 - 43596371
Alignment:
| Q |
8 |
atatgatcatatttatttgagtttggagcttttctcattgagagataataaccggaaagaacttaagggtactaatttccctta |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43596454 |
atatgatcatatttatttgagtttggagcttttctcattgagagataataaccggaaagaacttaagggtactaatttccctta |
43596371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.000000000007
Query Start/End: Original strand, 28 - 91
Target Start/End: Original strand, 48891494 - 48891557
Alignment:
| Q |
28 |
gtttggagcttttctcattgagagataataaccggaaagaacttaagggtactaatttccctta |
91 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||| || |||||||| |||||||||| |
|
|
| T |
48891494 |
gtttggagtttttctcattgagagataatatgtggaaagaaattgagggtacttatttccctta |
48891557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 29 - 91
Target Start/End: Complemental strand, 45372067 - 45372005
Alignment:
| Q |
29 |
tttggagcttttctcattgagagataataaccggaaagaacttaagggtactaatttccctta |
91 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||| ||||||| |||||||| | |||||||| |
|
|
| T |
45372067 |
tttggagtttttctcattgagagataatacttggagagaacttgagggtactcacttccctta |
45372005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University