View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16980_high_4 (Length: 313)
Name: NF16980_high_4
Description: NF16980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16980_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 32 - 290
Target Start/End: Original strand, 3299828 - 3300086
Alignment:
| Q |
32 |
gaaacttaataataatctctctcctagaatcactaaaaaagaaggtgagagggaatgattttagttaagaaaaaaccggagaagatatatcatatcatag |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3299828 |
gaaacttaataataatctctctcctagaatcactaaaaaagaaggtgagagggaatgattttagttaagaaaaaaccggagaagatatatcatatcatag |
3299927 |
T |
|
| Q |
132 |
cataagcatagcataggtttaggtatcattattattatactataaaattcgttatacggtcacaacaacattctgaattcaattctgattctgatagtga |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3299928 |
cataagcatagcataggtttaggtatcattattattatactataaaattcgttatacggtcacaacaacattctgaattcaattctgattctgatagtga |
3300027 |
T |
|
| Q |
232 |
tacaacgacctttgtggctctctgcccactgctctctgccaccccaccaccatcctgtt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3300028 |
tacaacgacctttgtggctctctgcccactgctctctgccaccccaccaccatcctgtt |
3300086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University