View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16980_high_8 (Length: 229)
Name: NF16980_high_8
Description: NF16980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16980_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 216
Target Start/End: Complemental strand, 21592688 - 21592490
Alignment:
| Q |
18 |
gttgctggatataatcgaagattgcataaactcgctttttcttcagatgaggaggaaatagcaaataaatctgacttgggtgaagaacataagtatgaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21592688 |
gttgctggatataatcgaagattgcataaactcgctttttcttcagatgaggaggaaatagcaaataaatctgacttgggtgaagaacataagtatgaga |
21592589 |
T |
 |
| Q |
118 |
ttactgaaagcatgcgtcaagagatggaatacagtgcagatcaagcatggtatgatagagaggaaggaagtacattgtttgattttgataactcttcac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21592588 |
ttactgaaagcatgcgtcaagagatggaatacagtgcagaccgagcatggtatgatagagaggaaggaagtacattgtttgattttgataactcttcac |
21592490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 67 - 171
Target Start/End: Original strand, 42095371 - 42095475
Alignment:
| Q |
67 |
aggaggaaatagcaaataaatctgacttgggtgaagaacataagtatgagattactgaaagcatgcgtcaagagatggaatacagtgcagatcaagcatg |
166 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| | |||||| |
|
|
| T |
42095371 |
aggaggaaatagcagataaatctgacttgggtgaagaacacaagtatgagattactgaaagcatgcgtcaagagatggaatatgatgcagaccgagcatg |
42095470 |
T |
 |
| Q |
167 |
gtatg |
171 |
Q |
| |
|
||||| |
|
|
| T |
42095471 |
gtatg |
42095475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 216
Target Start/End: Original strand, 42095574 - 42095624
Alignment:
| Q |
166 |
ggtatgatagagaggaaggaagtacattgtttgattttgataactcttcac |
216 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||||| |||||||| |
|
|
| T |
42095574 |
ggtatgatagagaggaaggcagcgcattgtttgattctgatagctcttcac |
42095624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University