View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16980_low_5 (Length: 302)
Name: NF16980_low_5
Description: NF16980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16980_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 70 - 287
Target Start/End: Original strand, 48587826 - 48588043
Alignment:
| Q |
70 |
ataaaacacttattttaaataactctttagtatccgacattagtctggtgtatgatttttgtgataaagtagagtttgtatattataattatcttcattt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48587826 |
ataaaacacttattttaaataactctttagtatccgacattagtctggtgtatgatttttgtgataaagtagagtttgtatattataattatcttcattt |
48587925 |
T |
 |
| Q |
170 |
tatttaaaagatatnnnnnnngttaaatttgtctaattaattaatgacaaattgttgttttgtttatgaattgtatgcccgaccggtgtatgattcagtg |
269 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48587926 |
tatttaaaagatataaaaaaatttaaatttgtctaattaattaatgacaaattgttgttttgtttatgaattgtatgcccgaccggtgtatgattcggtg |
48588025 |
T |
 |
| Q |
270 |
actcttttccaataaaac |
287 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
48588026 |
actctttttcaataaaac |
48588043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 13 - 41
Target Start/End: Original strand, 48587775 - 48587803
Alignment:
| Q |
13 |
aatataaatcgtgtattataattgtattc |
41 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48587775 |
aatataaatcgtgtattataattgtattc |
48587803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University