View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16980_low_6 (Length: 245)
Name: NF16980_low_6
Description: NF16980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16980_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 42377993 - 42378205
Alignment:
| Q |
18 |
agttaccactcgccataacaatccgtcagacttttgggcaggtataggccacttgccatcgtaaatcgttttgatcaagaagctgtcggttcaggtcatc |
117 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42377993 |
agttcccactcgccataacaatccgtcagacttttcggcacgtattggccacttgccgtcgtaaatcgttttgatcaagaagctgtcggttcaggtcatc |
42378092 |
T |
 |
| Q |
118 |
tcatgggcgcctcttcaacctgtttttgaggtcgtttgtctgatgcagagtctttatcaattctatccagcaaacccttgctcttcactcattgtctgaa |
217 |
Q |
| |
|
|| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42378093 |
tcgtgggcgcctcttcaacctgttttcgaggtcgtttgtctgatgcagagtctttatcaattctatccagcaaacccttgctcttcactcattgtctgaa |
42378192 |
T |
 |
| Q |
218 |
gctaccgtctctg |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42378193 |
gctaccgtctctg |
42378205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 42406707 - 42406919
Alignment:
| Q |
18 |
agttaccactcgccataacaatccgtcagacttttgggcaggtataggccacttgccatcgtaaatcgttttgatcaagaagctgtcggttcaggtcatc |
117 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42406707 |
agttcccactcgccataacaatccgtcagacttttcggcacgtattggccacttgccgtcgtaaatcgttttgatcaagaagctgtcggttcaggtcatc |
42406806 |
T |
 |
| Q |
118 |
tcatgggcgcctcttcaacctgtttttgaggtcgtttgtctgatgcagagtctttatcaattctatccagcaaacccttgctcttcactcattgtctgaa |
217 |
Q |
| |
|
|| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42406807 |
tcgtgggcgcctcttcaacctgttttcgaggtcgtttgtctgatgcagagtctttatcaattctatccagcaaacccttgctcttcactcattgtctgaa |
42406906 |
T |
 |
| Q |
218 |
gctaccgtctctg |
230 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42406907 |
gctaccgtctctg |
42406919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University