View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16981_high_4 (Length: 218)
Name: NF16981_high_4
Description: NF16981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16981_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 49587656 - 49587485
Alignment:
| Q |
19 |
taacatgaccaagagaaggctaaatatgacgcatgagagagatagggggcagcaaggagttatgtcgcatcaataatgattacaagtatgagtaaacaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49587656 |
taacatgaccaagagaaggctaaatatgacgcatgatagagatagggggcagcaaggagttatgtcgcatcaataatgattacaagtatgagtaaacaaa |
49587557 |
T |
 |
| Q |
119 |
gcatccaagctaagccgtggactgtggacagacacaacacataatccctcaacgtcaataagcaacttgaca |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49587556 |
gcatccaagctaagccgtggactgtggacagacacaacacataatccctcaacgtcaataagcaacttgaca |
49587485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University