View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16981_low_8 (Length: 242)
Name: NF16981_low_8
Description: NF16981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16981_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 5053494 - 5053267
Alignment:
| Q |
1 |
cggtcatttctaggtcaaggttcatgttcatactctccaaatgattatgaaacgaatgaaagnnnnnnnnn--tcatcaaatcaagcaacaaagtcattc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
5053494 |
cggtcatttctaggtcaaggttcatgttcatactctccaaatgattatgaaacaaatgaaagaaaaaaaataatcagcaaatcaagcaacaaagtcattc |
5053395 |
T |
|
| Q |
99 |
catgttaaatttcttacacgcatcttataacatggttggatgaagattaaatgaacacattcttgtgaaatttgcctgtcaattattttgannnnnnncg |
198 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5053394 |
cttgttaaatttcttacacgcatcttataacatggttggatgaagattaaatgaacacattcttgtgaaatttgcctgtcaattattttgattttttt-g |
5053296 |
T |
|
| Q |
199 |
tttcttgttggttttgaatttaagatgat |
227 |
Q |
| |
|
||||||||||||||||||||||| ||||| |
|
|
| T |
5053295 |
tttcttgttggttttgaatttaaaatgat |
5053267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University