View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16982_low_2 (Length: 273)
Name: NF16982_low_2
Description: NF16982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16982_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 52 - 252
Target Start/End: Original strand, 32469015 - 32469216
Alignment:
| Q |
52 |
caacatagtccacaaattgcactcgtgggatacactgcttctacatatgtcatttgtcaacattaaataaatagtccaaaccaacttatttatgatatgt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32469015 |
caacatagtccacaaattgcactcgtgggatacactgcttctacatatgtcatttgtcaacattaaataaatagtccaaaccaacttatttatgatatgt |
32469114 |
T |
|
| Q |
152 |
agctcaacaatgaagctattgtcccaccttgaattgatgg-nnnnnnnnntgaatgatcactttgtttacctcatttttgtggcatagtgatgttatagt |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32469115 |
agctcaacaatgaagttattgtcccaccttgaattgatggaaaaaaaaaatgaatgatcactttgtttacctcatttttgtggcatagtgatgttatggt |
32469214 |
T |
|
| Q |
251 |
at |
252 |
Q |
| |
|
|| |
|
|
| T |
32469215 |
at |
32469216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University