View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16982_low_3 (Length: 247)
Name: NF16982_low_3
Description: NF16982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16982_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 51069560 - 51069793
Alignment:
| Q |
1 |
ttcagcaagtttacagtttatttaactaattccaacagactagaggtgccttctaaactggctatatatgtattggctagttcaataacatgggtattgc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51069560 |
ttcagtaagtttacagtttatttaactaattccaacagactagaggtgccttctaaactggctatatatgtattggctagttcaataacatgggtattgc |
51069659 |
T |
|
| Q |
101 |
agctagtcttttnnnnnnnnnttaagtatttaaataatagttnnnnnnnttaatattttaacataatcttttagtaacaagtctctttatcccactcaaa |
200 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51069660 |
agctagtcttttaaaaaaaaattaagtctttaaataatagtt-aaaaaattaatattttaacataatcttttagtaacaagtctctttatcccactcaaa |
51069758 |
T |
|
| Q |
201 |
gtaagaccaagacggggacacttttggattaacat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
51069759 |
gtaagaccaagacggggacacttttggattaacat |
51069793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University