View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16982_low_4 (Length: 236)

Name: NF16982_low_4
Description: NF16982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16982_low_4
NF16982_low_4
[»] chr4 (1 HSPs)
chr4 (1-220)||(51069142-51069361)


Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 51069361 - 51069142
Alignment:
1 ttaaaagaaggactttgaagctaatttggatcgattcaagaaacaagcaggcttaattaacaaataaatgattcattcgaccataaacaattttttacca 100  Q
    |||||||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||    
51069361 ttaaaagaaggactttgaagcttatttggatcgattcaagaaacaagtagacttaattaacaaataaatgattcattcgaccataaacaattttttacca 51069262  T
101 aacttctaagacacggtccacacggagtgcaatacatccccataaacctaattttagtagaaaatcatagtcaacatcatatgattgatgacaaaaatta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51069261 aacttctaagacacggtccacacggagtgcaatacatccccataaacctaattttagtagaaaatcatagtcaacatcatatgattgatgacaaaaatta 51069162  T
201 gcataattaagggtaaacat 220  Q
    ||||||||||||||||||||    
51069161 gcataattaagggtaaacat 51069142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University