View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16983_low_8 (Length: 211)
Name: NF16983_low_8
Description: NF16983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16983_low_8 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 211
Target Start/End: Original strand, 4933415 - 4933609
Alignment:
| Q |
17 |
actgaggtgtaggagattgcataaatgttccactatgaaaactccaagcaggtgaactaccaccaacattactagattcttccaaattttctatgttatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4933415 |
actgaggtgtaggagattgcataaatgttccactatgaaaactccaagcaggtgaactaccaccaacattactagattcttccaaattttctatgttatc |
4933514 |
T |
|
| Q |
117 |
atctgaatctagtgaagtttgtgatgaaattgaagcacttgaatgctttttgtgatgatcaattggattttctccatccttaggaagaccaaaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4933515 |
atctgaatctagtgaagtttgtgatgaaattgaagcacttgaatgctttttgtgatgatcaattggattttctccatccttaggaagatcaaaat |
4933609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University