View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16984_high_10 (Length: 268)
Name: NF16984_high_10
Description: NF16984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16984_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 139 - 251
Target Start/End: Complemental strand, 54080584 - 54080472
Alignment:
| Q |
139 |
ctgatcctttgcgtgaacagctcatctcatggttataggtgaggtagggattttgtctgtgcaccagaaagtctactttttgttttgccaatagtggtgg |
238 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54080584 |
ctgatcctttgcgtggacagctcatctcatggttataggtgaggtagggattttgtctgtgcaccagaaagtctactttttgttttgccaatagtggtgg |
54080485 |
T |
 |
| Q |
239 |
tgccactgtcagt |
251 |
Q |
| |
|
||||||||||||| |
|
|
| T |
54080484 |
tgccactgtcagt |
54080472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 20 - 106
Target Start/End: Complemental strand, 54080706 - 54080620
Alignment:
| Q |
20 |
catatgatggccactaaccatagtggaggatgaaaggctgtttattattgactatatgcatgataatatgacatggtgtttttgctc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54080706 |
catatgatggccactaaccatagtggaggatgaaaggctgtttattattgactatatgcatgataatatgacatggtgtttttgctc |
54080620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University