View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16984_high_7 (Length: 304)
Name: NF16984_high_7
Description: NF16984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16984_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 168 - 295
Target Start/End: Original strand, 10103642 - 10103769
Alignment:
| Q |
168 |
tcttaaacttaacataagtttaatgttttatattagataatggagatacgcccaaatgtaaactggaataaaggtgatgctctaatgtattttcttgaca |
267 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10103642 |
tcttaaacttaacataagttgaatgttttatattagattatggagatacgcccaaatgtgaactggaataaaggcgatgctctaatgtattttcttgaca |
10103741 |
T |
 |
| Q |
268 |
ctcttggatataacacctttgatgatgt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
10103742 |
ctcttggatataacacctttgatgatgt |
10103769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 124 - 168
Target Start/End: Original strand, 10103515 - 10103559
Alignment:
| Q |
124 |
tgacagagaaaatgaaatatctctcttatttatctgtctttaaat |
168 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
10103515 |
tgacggagaaaatgaaatctctttcttatttatcagtctttaaat |
10103559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University