View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16984_low_16 (Length: 241)
Name: NF16984_low_16
Description: NF16984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16984_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 219
Target Start/End: Original strand, 53453589 - 53453791
Alignment:
| Q |
17 |
aaaatcaatgatttcgcaaaactcaacgacatcaaaatcgtgtgcattgattcatcaccggaggaagatgaacatgttgtgaacttttctgctttaacaa |
116 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||||||| |||||||| |
|
|
| T |
53453589 |
aaaatcaacgatttcgcaaaactcatcgacatcaaaatcgtgtgcattgattcatcaccggaggaagatgaaaatgttgtggatttttctgttttaacaa |
53453688 |
T |
|
| Q |
117 |
atgctgatgaaaacgaattaccagaagttaaaataaacccaaacgacgtggttgcgttaccgttttcttcaggaacttctggtttaccaaaaggtgttat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53453689 |
atgctgatgaaaacgaattaccagaagtaaaaataaacccaaacgatgtagttgcgttaccgttttcttcaggaacttctggtttaccaaaaggtgttat |
53453788 |
T |
|
| Q |
217 |
gtt |
219 |
Q |
| |
|
||| |
|
|
| T |
53453789 |
gtt |
53453791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University