View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16984_low_19 (Length: 204)
Name: NF16984_low_19
Description: NF16984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16984_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 21 - 188
Target Start/End: Original strand, 51962521 - 51962679
Alignment:
| Q |
21 |
gaaaacacatgtgtacaacacaattgtcactatccacaacctagattgacaaaccacaagacaattcatcctcaactagctaggagtaatatattaactt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51962521 |
gaaaacacatgtgtacaacacaattgtcactatccacaacctagattgacaaaccacaagacaattcatcctcaa----ctaggagtaatatattaactt |
51962616 |
T |
 |
| Q |
121 |
atatcttaaaattgcaatgcaatgcctgaattaaaagcctctctacactctagatctgtgtctctgtg |
188 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51962617 |
atatcttaaaat-----tacaatgcctgaattaaaagcctctctacactctagatctgtgtctctgtg |
51962679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University