View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16984_low_3 (Length: 452)
Name: NF16984_low_3
Description: NF16984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16984_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 43 - 432
Target Start/End: Complemental strand, 2587719 - 2587328
Alignment:
| Q |
43 |
cttgctgtcggtttagatcggctttgtttgcttatgttgaccataattctattctgattctatccacgtttcttgtctgnnnnnnng-ttccattccatt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
2587719 |
cttgctgtcggtttagatcggctttgtttgcttatgttgaccataattctattctgattctatccacgtttcttgtccgttttttttattccattccatt |
2587620 |
T |
|
| Q |
142 |
ccacacatttactgcactgcactgcatagnnnnnnnnattttctagaaatctattactctctgatttttaagatttcagctgtttatagtattactgttg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2587619 |
ccacacatttactgcactgcactgcatagttttttttattttctagaaatctattactctctgatttttaagatttcagctgtttatagtattactgttg |
2587520 |
T |
|
| Q |
242 |
agcggaaatgttttgccgattttgcccctgttccctttttt-agagtttttgtaattgttgctctaaaggtttggatctagatattttgtttgtttaata |
340 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2587519 |
agcggaaatgttttgccgatttcgcccctgttccctttttttagagtttttgtaattgttgctctaaaggtttggatctagatattttgtttgttaaata |
2587420 |
T |
|
| Q |
341 |
ttttacaaactctgttctgtttgatgcatgaaccgttttttagctactaggcaagaaattagtgaagggttatttaaatatgatgtcataaa |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2587419 |
ttttacaaactctgttctgtttgatgcatgaaccattttttagctactaggcaagaaattagtgaagggttatttaaatatgatgtcataaa |
2587328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University