View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16984_low_8 (Length: 326)
Name: NF16984_low_8
Description: NF16984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16984_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 21 - 313
Target Start/End: Original strand, 782355 - 782645
Alignment:
| Q |
21 |
gctcattctaaaaattccaatcaattttatccgggnnnnnnnatatctggatatggattttgttgttgataaatcacgtttccggtgaaatcaaatctag |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
782355 |
gctcattctaaaaattccaatcaattttatccgggtttttttatatccggatatggattttgttgttgataaatcacgtttccggtgaaatcaaatctag |
782454 |
T |
|
| Q |
121 |
ttatatgtggattggttttaaaatccgattatagtaaatgcnnnnnnnatggatgtggactgattatatgatattctatccataagcaaccctacttgtc |
220 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
782455 |
ttat--gtggattggttttaaaatccgattatagtaaatgctttttttatggatgtggactgattatatgatattctatccataagcaaccctacttgtc |
782552 |
T |
|
| Q |
221 |
acatgtgcaatggagacttttgatttaaattcttgctttaaaatgcaacttttttctggtcaacaatgttttactatctcattccccctttgc |
313 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
782553 |
acatgtgcaatggagactttagatttaaattcttgctttaaaatgcaacttttttctggtcaacaatgttttactatctcattccccctttgc |
782645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University