View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16984_low_9 (Length: 311)
Name: NF16984_low_9
Description: NF16984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16984_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 52 - 114
Target Start/End: Complemental strand, 2588110 - 2588048
Alignment:
| Q |
52 |
cactcactcacatgcaatcatgcatacagctaactaactctgtagcatgcagttgatagtagt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2588110 |
cactcactcacatgcaatcatgcatacagctaactaactctgtagcatgcagttggtagtagt |
2588048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 180 - 229
Target Start/End: Complemental strand, 2587985 - 2587936
Alignment:
| Q |
180 |
aacaacagagtcagcttttgtttaaatttaatcaaacaaacaccacacac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2587985 |
aacaacagagtcagcttttgtttaaatttaatcaaacaaacaccacacac |
2587936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University