View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16986_high_6 (Length: 426)
Name: NF16986_high_6
Description: NF16986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16986_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 96 - 284
Target Start/End: Original strand, 45671407 - 45671595
Alignment:
| Q |
96 |
actaaccttgatactaactgagtaaagaaccatatcatcgaccgtggtaacattaagatgaagaatggtaagcctaagattttgtaacccaacaacaatc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45671407 |
actaaccttgatactaactgagtaaagaaccatatcatcgaccgtggtaacattaagatgaagaatggtaagcctaagattttgtaacccaacaacaatc |
45671506 |
T |
|
| Q |
196 |
ttcataagttgtcctggttttttcttggatagaattttcatgttggcatgactatctaccattgtaacttcaatgtctgcaacagccca |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45671507 |
ttcataagttgtcctggttttttcttggatagaattttcatgttggcatgactatctaccattgtaacttcaatgtctgcaacagccca |
45671595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 362 - 414
Target Start/End: Original strand, 45671676 - 45671728
Alignment:
| Q |
362 |
actgaggaaaagtgaagaattcagcaaagggtggtccattatttaagcctatg |
414 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45671676 |
actgaggaaaagtgaagaattcagcaaaaggtggtccattatttaagcctatg |
45671728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University