View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16986_low_7 (Length: 355)
Name: NF16986_low_7
Description: NF16986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16986_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 48393282 - 48393540
Alignment:
| Q |
1 |
agcaggcatgtttgcataatcgattgggtgatgtcacgaataataaaataatttcattttcaatgtcaacaactagcaaa--attctg----------ag |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |||| ||| || | |
|
|
| T |
48393282 |
agcaggcatgtttgcataatcgattgggtgatgtcacgaataataa-----tttcattttcaatgtcaac---taacaaagcattgtggatatataataa |
48393373 |
T |
 |
| Q |
89 |
acatctgaactcgcttcctcctccattttgcgtacaata-----tccatgtatgtatctcagcgaattggaaatacaatccaaatcttcatccatgtctg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48393374 |
acatctgaactcgcttcctcctccattttgcgtacaatataatatccatgtatgtatctctgcgaattggaaatacaatccaaatcttcatccatgtctg |
48393473 |
T |
 |
| Q |
184 |
cagcagcttcgagatcatgatcaggaattgcagcctccttatcagatagaaaagtagcattgtcgat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48393474 |
cagcagcttcgagatcatgatcaggaattgcagcctccttatcagatagaaaagtagcattgtcgat |
48393540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 314 - 350
Target Start/End: Original strand, 48393539 - 48393575
Alignment:
| Q |
314 |
ataatcacattatgaatttcatttttattttcttcga |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48393539 |
ataatcacattatgaatttcatttttatttttttcga |
48393575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University