View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16986_low_8 (Length: 353)
Name: NF16986_low_8
Description: NF16986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16986_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 15 - 348
Target Start/End: Complemental strand, 45083617 - 45083284
Alignment:
| Q |
15 |
aagtgagagaacggggatggaagagagaattcttgtgaagggaaagtccattgatctgagattggagggtagaggaacatagagaagttgtagttgaagc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45083617 |
aagtgagagaacggggatggaagagagaattcttgtgaagggaaagtccattgatctgagattggagggtagaggaacatagagaagttgtagttgaagc |
45083518 |
T |
 |
| Q |
115 |
catcttgtcttgtgctttgaatttggaacttttctccttttcacaaagtgtgtcgattgagctgaagattgttgtttgtttgttatgtacaatgaatgaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45083517 |
catcttgtcttgtgctttgaatttggaacttttctccttttcacaaagtgtgtcgattgagctgaagattgttgtttgtttgttatgtacaatgaatgaa |
45083418 |
T |
 |
| Q |
215 |
tgaacgatgttgtaaatccagaaaggaaaatcgtgtggatgacacgtgttggtggggacttgacttggatgtgcttatctgcaatggttggttggttcgt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45083417 |
tgaacgatgttgtaaatccagaaaggaaaatcgtgtggatgacacgtgttggtggggacttgacttggatgtgcttatctgcaatggttggttggttcgt |
45083318 |
T |
 |
| Q |
315 |
tcgttcgttcgcgctctgcttctcttcatctctc |
348 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
45083317 |
tcgttcgttcgcgctctgcttctcttcttctctc |
45083284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University