View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16988_low_11 (Length: 360)
Name: NF16988_low_11
Description: NF16988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16988_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 345
Target Start/End: Complemental strand, 26783929 - 26783589
Alignment:
| Q |
18 |
cttaaaattgattacaatcccaaatccaattctattgaaaagctttgatttctatctttttgcagtcatataaaataagctcacaagtttgttaacaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| | |
|
|
| T |
26783929 |
cttaaaattgattacaatcccaaatccaattctattgaaaagctttgatttctatctttttgcagtgatataaaataagctcacaagtttattaacatag |
26783830 |
T |
|
| Q |
118 |
atagatacatacacacnnnnnnnnnnnntatagagctatcaaaatggctagtttgagtgctcatatgatggatccaactacataaatggattaaatcggg |
217 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26783829 |
atagatacatacacacaaaaagaaaaaatatagagctatcaaaatggctagtttgagtgctcatatgatggatccaactacataaatggactaaatcggg |
26783730 |
T |
|
| Q |
218 |
tcaatatattgttagtgggtcagttcgaccc-----------ctatttatgggttattcactcatttatgttttatgtcattttgatatattagtttctc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26783729 |
tcaatatattgttagtgggtcagttcgacccattccatttttctatttatggattattcactcatttatgttttatgtcattttgatatattagtttctc |
26783630 |
T |
|
| Q |
307 |
aaaattatatgctt--tgagatatttttcttttggttttcc |
345 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26783629 |
aaaattatatgcttggtgagatatttttcttttggttttcc |
26783589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University