View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16988_low_15 (Length: 244)
Name: NF16988_low_15
Description: NF16988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16988_low_15 |
 | |
|
| [»] scaffold1262 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 9 - 230
Target Start/End: Complemental strand, 27147956 - 27147735
Alignment:
| Q |
9 |
gaggagcatcacatttaaggccgcatttggatccaatttgaaaaaagggcaagaggaattcatgggaatcttgcaagagttttcgaaacttttcggagca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27147956 |
gaggagcatcacatttaaggccgcatttggatccaatttgaaaaaagggcaagaggaattcatgggaatcttgcaagagttttcgaaacttttcggagca |
27147857 |
T |
|
| Q |
109 |
ttcgacattgccgaatttattccttggttgggttggtttaatgggcaggatttcaacaaaaggttggctagtgcaagaaaagcacttgatgtgtttattg |
208 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27147856 |
ttcaacattgccgaatttattccttggttgggttggtttaatgggcaggatttcaacaaaaggttggctagtgcaagaaaagcacttgatgtgtttattg |
27147757 |
T |
|
| Q |
209 |
ataagattattgatgatcatgt |
230 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
27147756 |
atgagattattgatgatcatgt |
27147735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 181 - 230
Target Start/End: Original strand, 21179751 - 21179800
Alignment:
| Q |
181 |
gcaagaaaagcacttgatgtgtttattgataagattattgatgatcatgt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21179751 |
gcaagaaaagcacttgatgtgtttattgatgagattattgatgatcatgt |
21179800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 113 - 155
Target Start/End: Original strand, 21179711 - 21179753
Alignment:
| Q |
113 |
acattgccgaatttattccttggttgggttggtttaatgggca |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21179711 |
acattgccgaatttattccttggttgggttggtttaatgggca |
21179753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1262 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: scaffold1262
Description:
Target: scaffold1262; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 37 - 230
Target Start/End: Original strand, 1 - 194
Alignment:
| Q |
37 |
ggatccaatttgaaaaaagggcaagaggaattcatgggaatcttgcaagagttttcgaaacttttcggagcattcgacattgccgaatttattccttggt |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1 |
ggatccaatttgaaaaaagggcaagaggaattcatgggaatcttgcaagagttttcgaaacttttcggagcattcaacattgccgaatttattccttggt |
100 |
T |
|
| Q |
137 |
tgggttggtttaatgggcaggatttcaacaaaaggttggctagtgcaagaaaagcacttgatgtgtttattgataagattattgatgatcatgt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
101 |
tgggttggtttaatgggcaggatttcaacaaaaggttggctagtgcaagaaaagcacttgatgtgtttattgatgagattattgatgatcatgt |
194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University