View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16989_low_9 (Length: 268)
Name: NF16989_low_9
Description: NF16989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16989_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 52564863 - 52564970
Alignment:
| Q |
1 |
ttcttctctatcaccatcatatcctactctctttgacccacaagatcaagttcaacaaccatcttattactgccaaacaaaccacttaccacatgatcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52564863 |
ttcttctctatcaccatcatatcctactctctttaactcacaagatcaagttcaaaaaccatcttattactgccaaacaaaccacttaccacatgatcaa |
52564962 |
T |
 |
| Q |
101 |
gaggtaaa |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
52564963 |
gaggtaaa |
52564970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 171 - 253
Target Start/End: Original strand, 52565033 - 52565115
Alignment:
| Q |
171 |
gtagcataattaatcccttccaatattttgtgatttgatcctctttaattaatttgatgatgtgatcttaattaggttgagaa |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52565033 |
gtagcataattaatcccttccaatattttgtgatttgatcctctttaattaatttgatgatgtgatcttaattaggttgagaa |
52565115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University