View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1698_high_15 (Length: 314)
Name: NF1698_high_15
Description: NF1698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1698_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 44024027 - 44023827
Alignment:
| Q |
17 |
tcccggaagcactcgttaacaagactcttgatattatatcatcacttgcaagtaaatatctcatacattgcaatgatatggtcttatttagagaatcaaa |
116 |
Q |
| |
|
|||||| |||| |||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44024027 |
tcccgggagcattcgttaacaaaactcttaatattatatcatcacttgcaagtaaatatctcatacattgcaatgatatagtcttatttagagaatcaaa |
44023928 |
T |
 |
| Q |
117 |
agaaaaattgaattggaggtcggagattcaaagacaagtcttagatcgaatagcttgaataaaagcaagtatgtaaaatgtaaacgagtcctagtaaata |
216 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44023927 |
agaaaaattggattggaggttggagattcaaagacaagtcttaaatcgaatagcttgaataaaagcaagtatgtaaaatgtaaacgagtcctagtaaata |
44023828 |
T |
 |
| Q |
217 |
a |
217 |
Q |
| |
|
| |
|
|
| T |
44023827 |
a |
44023827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University