View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1698_high_18 (Length: 304)
Name: NF1698_high_18
Description: NF1698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1698_high_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 17 - 292
Target Start/End: Original strand, 45179278 - 45179555
Alignment:
| Q |
17 |
tatactctttgaagcactaatgctggcactcttcaataagctgtgtggaatgtagtttggcttcgagagtccatttaatttgcacgcctgacgttttagc |
116 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45179278 |
tatactctttgaagcacattagctggcactcttcaataagctgtgtggaatgtagtttggcttcgagagtccatttaatttgcacgcctgacgttttagc |
45179377 |
T |
|
| Q |
117 |
atctgtcacattataccctggaggt--ctctgaagatttgatccagtcagcatttcaatatcgttattttcattcttggaaatatgaactcagtaattac |
214 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45179378 |
atctgtcacattataccctggaggtgtctctgaagatttgatccagtcagcatttcaatatcgttattttcattcttggaaatatgaactcggtaattac |
45179477 |
T |
|
| Q |
215 |
ataaagtgaaattgcaatactcaatgcatttgactcacaatatcagagaaaatgtttcaaaggcatgttgccaacctc |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45179478 |
ataaagtgaaattgcaatactcaatgcatttgactcacaatatcagagaaaatgtttcaaaggcatgttgccaacctc |
45179555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 17 - 188
Target Start/End: Original strand, 45172463 - 45172630
Alignment:
| Q |
17 |
tatactctttgaagcactaatgctggcactcttcaataagctgtgtggaatgtagtttggcttcgagagtccatttaatttgcacgcctgacgttttagc |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||| ||||| ||||||||||||| | |||||||||| || ||||||| ||| ||| |
|
|
| T |
45172463 |
tatacactttgaagcactaatgctggcactcttcaacaagctacgtggactgtagtttggctttgcgagtccattt----tgagcgcctgagttttcagc |
45172558 |
T |
|
| Q |
117 |
atctgtcacattataccctggaggtctctgaagatttgatccagtcagcatttcaatatcgttattttcatt |
188 |
Q |
| |
|
||||||||||||| | |||||||| |||||||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
45172559 |
atctgtcacattagaacctggagggctctgaagatctgatccagttggcatttcaatatcgttgttttcatt |
45172630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University