View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1698_high_22 (Length: 265)
Name: NF1698_high_22
Description: NF1698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1698_high_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 13 - 244
Target Start/End: Original strand, 54885814 - 54886045
Alignment:
| Q |
13 |
atactatacatgatctcgttccttcatggtgggaatatccttacctcattcttatgctgaatttatagtagataaaagcaatttactgcttaaacggtgc |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
54885814 |
ataccatacatgatctcgttccttcatggtgggaatatccttacctcattcttatgctgaatttatagtagataaaagcaatttactgcttaaacagcgc |
54885913 |
T |
|
| Q |
113 |
ataacggcagtgttatggagcctttggaaacaccgtaaccttaaattgtggcaaaacgaacaagagctgtgtgttcatgttgttgatccgggctcgacac |
212 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54885914 |
atggcggcagtgttatggagcctttggaaacaccgtaaccttaaattttggcaaaacgaacaagagctgtgtgttcatgtttttgatccgggctcgacac |
54886013 |
T |
|
| Q |
213 |
ttaatggacgaatggctgtcagcgcaacctca |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
54886014 |
ttaatggacgaatggctgtcagcgcaacctca |
54886045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University