View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1698_high_23 (Length: 253)
Name: NF1698_high_23
Description: NF1698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1698_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 7750276 - 7750524
Alignment:
| Q |
1 |
ttccatggaaaattggcccggccgagttatcaggattttcgatcagtggtgtaaacataagaaatttggaaacatcaatcccgggaaggaaaacataagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7750276 |
ttccatggaaaattggcccggccgagttatcaggattttcgatcagtggtgtaaacataagaaatttggaaacatcaatcccgggaaggaaaacataagg |
7750375 |
T |
|
| Q |
101 |
gccatcaccaaagaacaaaacaccactagatgtttttgaagaactcaaacatattgcaaactttgttttgaagttgaaagcagaagcaaaaagtgaaggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7750376 |
gccatcaccaaagaacaaaacaccactagatgtttttgaagaactcaaacatattgcaaactttgttttgaagttgaaagcagaagcaaaaagtgaaggt |
7750475 |
T |
|
| Q |
201 |
aatgaaatattactctttccaaaacctaccatgcctttgctactccactag |
251 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
7750476 |
aatgaaatattactctttccaaaacctgccatgcctttg--actccactag |
7750524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University