View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1698_high_24 (Length: 251)

Name: NF1698_high_24
Description: NF1698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1698_high_24
NF1698_high_24
[»] chr8 (2 HSPs)
chr8 (4-247)||(9336584-9336827)
chr8 (103-173)||(8209356-8209426)
[»] chr1 (1 HSPs)
chr1 (103-188)||(42365183-42365268)


Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 4 - 247
Target Start/End: Original strand, 9336584 - 9336827
Alignment:
4 cacagtctttttgagaaaatgacctaacagattcaaagttctaactccacccaaatcaccgttaaaagcaaaaaccctacctaccaaaaactgagacatt 103  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
9336584 cacagtctttttgagaaaatgacctaccagattcaaagttctaactccacccaaatcaccgttaaaagcaaaaaccctacctaccaaaaactgaaacatt 9336683  T
104 aaccgaattcaaggatgcgaagatccttaggatcggtgatggatttacagatagaagccaaatcgatattcacttcacttcgcacctcccggttcgaatg 203  Q
    |||||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||    
9336684 aaccgaattcaaggatgcgagggtccttaggatcgatgatggatttacagatagaagccaaatcgatattcgcttcacttcgcacctcccagttcgaatg 9336783  T
204 aaaacgactatccttccattctgataacattattcatctcactc 247  Q
    |||| |||||||||||||||||||||||||||||| || |||||    
9336784 aaaaagactatccttccattctgataacattattcttcgcactc 9336827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 103 - 173
Target Start/End: Original strand, 8209356 - 8209426
Alignment:
103 taaccgaattcaaggatgcgaagatccttaggatcggtgatggatttacagatagaagccaaatcgatatt 173  Q
    |||||||||| | | |||||| |||| ||||||||||||||||| | | ||| |||||| |||||||||||    
8209356 taaccgaattgacgaatgcgaggatcgttaggatcggtgatggagtgaaagagagaagctaaatcgatatt 8209426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 103 - 188
Target Start/End: Original strand, 42365183 - 42365268
Alignment:
103 taaccgaattcaaggatgcgaagatccttaggatcggtgatggatttacagatagaagccaaatcgatattcacttcacttcgcac 188  Q
    |||||||||||| |||||||| | || |||||||||||||| || | ||||| |||||||| ||| |||||  ||||| |||||||    
42365183 taaccgaattcacggatgcgagggtctttaggatcggtgattgagtcacagagagaagccagatcaatattggcttcatttcgcac 42365268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University