View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1698_high_32 (Length: 237)
Name: NF1698_high_32
Description: NF1698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1698_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 15 - 219
Target Start/End: Original strand, 47687858 - 47688062
Alignment:
| Q |
15 |
gaatatgaaatgtcggaaatgctttgggnnnnnnnaaccatccattcttttagaatctaaaatgtcaatatataaggcgataaagaatgaattttgattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47687858 |
gaatatgaaatgtcggaaatgctttgggtttttttaaccatccattcttttagaatctaaaatgtcaatatataaggccataaagaatgaattttgattt |
47687957 |
T |
 |
| Q |
115 |
cttaactatccatgatctttatagataagaaataaaatgtcaattagactaaaaaggagttttgattgcttataactatatattatctttatgaatagaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47687958 |
cttaactatccatgatctttatagataagaaataaaatgtcaattagactaaaaaggagttttgattgcttataactatatattatctttatgaatagaa |
47688057 |
T |
 |
| Q |
215 |
actaa |
219 |
Q |
| |
|
||||| |
|
|
| T |
47688058 |
actaa |
47688062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 96 - 136
Target Start/End: Complemental strand, 36346927 - 36346887
Alignment:
| Q |
96 |
aaagaatgaattttgatttcttaactatccatgatctttat |
136 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||| |||||||| |
|
|
| T |
36346927 |
aaagaatgaattttgattgcttaactattcattatctttat |
36346887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University