View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1698_low_28 (Length: 250)
Name: NF1698_low_28
Description: NF1698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1698_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 9336366 - 9336593
Alignment:
| Q |
19 |
aggatatatgcgatcatttattcaggaacattcnnnnnnnccttgaactgcaaagattaataatagatcatatcgaaaatgagagtgagtacaagtaact |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9336366 |
aggatatatgcgatcatttattcaggaacattctttttttccttgaactgcaaagattaataatagatcatatcgaaaatgagagtgagtacaagtaact |
9336465 |
T |
 |
| Q |
119 |
cgttcatcaacattgttgtccagctggttttggtcttcactcttctgattaatgttcttgtggctgtatatatatgtggttgggactgtgttggctttct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
9336466 |
cgttcatcaacattgttgtccagctggttttggtcttcactcttctgattaatgttcttgtggctg--tatatatgtggttgggactgtcttggctttct |
9336563 |
T |
 |
| Q |
219 |
cttcatgtgatattccttgtcacagtcttt |
248 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |
|
|
| T |
9336564 |
cttcgtgtgatattccttgtcacagtcttt |
9336593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University