View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1698_low_39 (Length: 231)
Name: NF1698_low_39
Description: NF1698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1698_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 21302609 - 21302820
Alignment:
| Q |
1 |
aactcaacggtaagcacgcaaaccctagaagtggacgatattttggaagtcgtagatgagat------gttttagatttgaaaggnnnnnnnngaa-gat |
93 |
Q |
| |
|
||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||| |
|
|
| T |
21302609 |
aactcaatagtaaacacacaaaccctagaagtggacgatattttggaagtcgtagatgagactttagggttttagatttgaaaggaaaaaaaaaaaagat |
21302708 |
T |
 |
| Q |
94 |
caaattagaacttagaaaggaagattagttcagttgataagaaattgacttatc-tttttgtgaatggtatgcaagcatctcccttacgttcattgagct |
192 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21302709 |
caaatgagaacctagaaaggaagattagttcagttgataagaaattgacttatcttttttgtgaatggtatgcaaacatctcccttacgttcattgagct |
21302808 |
T |
 |
| Q |
193 |
ttaagtctttct |
204 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
21302809 |
ttgagtctttct |
21302820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University