View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1698_low_40 (Length: 227)
Name: NF1698_low_40
Description: NF1698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1698_low_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 4860735 - 4860936
Alignment:
| Q |
19 |
aaatatgtccaagaaagaaacacaatgttaaggatagagttgatatagtagctagctagctagctggcaacgtatctagggcgaagctgatttgacactg |
118 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4860735 |
aaatatgtccaagaaagaaaaataatgttaaggatagagttgatatagtagc----tagctagctggcaacgtatctagggtgaagctgatttgacactg |
4860830 |
T |
|
| Q |
119 |
catgcagggggcccaaataagcattccctacggcccccaacagcatgtagcactcggagaattaacaccctactctttctattcaatccaccagcaaccc |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4860831 |
catgcagggggcccaaataagcaatccctacggcccccaacagcatgtagcactcggagaattaacaccctactctttctattcaatccaccagcaaccc |
4860930 |
T |
|
| Q |
219 |
tatgct |
224 |
Q |
| |
|
|||||| |
|
|
| T |
4860931 |
tatgct |
4860936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University