View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1699-Insertion-1 (Length: 355)
Name: NF1699-Insertion-1
Description: NF1699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1699-Insertion-1 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 8 - 355
Target Start/End: Complemental strand, 21983236 - 21982866
Alignment:
| Q |
8 |
gcagctgcaatcatggccattgtattggccaatggaggggtatgt----gattgagattatttgcaaatgtttcatttttctaagttgttatgtgacaca |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21983236 |
gcagctgcaatcatggccattgtattggccaatggaggggtatgtatgcgattgagattatttacaaatgtttcatttttctaagttgttatgtgacaca |
21983137 |
T |
|
| Q |
104 |
tatat----------------tgataacagggaaaaccgccggattggcaagatttcactggtattatggtgttgcttatcattaactcaacgattagtt |
187 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21983136 |
tatatactcgtatgcatatattgataacagggaaaaccaccggattggcaagatttcactggtattatggtgttgcttatcattaactcaacgattagtt |
21983037 |
T |
|
| Q |
188 |
tcattgaggaaaacaatgccggaaatgctgcagctgctttgatggccggtcttgcccccaaaaccaaggtaacttttgttattacatgt---tatgatct |
284 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | | |||||||| |
|
|
| T |
21983036 |
tcattgaggaaaacaatgctggaaatgctgcagctgctttgatggccggtcttgccccaaaaaccaaggtaacttttgttattacttattcatatgatct |
21982937 |
T |
|
| Q |
285 |
attagcattcaatagctaacaagaactaagcaattttaattttgtaggtgttgagggatggaaaatggagt |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21982936 |
attagcattcaatagctaacaagaactaagcaattttaattttgtaggtgttgagggatggaaaatggagt |
21982866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 130 - 258
Target Start/End: Complemental strand, 45200051 - 45199923
Alignment:
| Q |
130 |
gattggcaagatttcactggtattatggtgttgcttatcattaactcaacgattagtttcattgaggaaaacaatgccggaaatgctgcagctgctttga |
229 |
Q |
| |
|
|||||||| ||||| ||| ||||||| |||||||||||||||||||| |||||||| || || ||||||||||| ||||||||||| || || | | |
|
|
| T |
45200051 |
gattggcaggattttgttggaattatggccttgcttatcattaactcaaccattagttttatagaagaaaacaatgctggaaatgctgctgcagcactta |
45199952 |
T |
|
| Q |
230 |
tggccggtcttgcccccaaaaccaaggta |
258 |
Q |
| |
|
|||| |||||||| ||||||||||||||| |
|
|
| T |
45199951 |
tggctggtcttgctcccaaaaccaaggta |
45199923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 112 - 259
Target Start/End: Complemental strand, 48439646 - 48439499
Alignment:
| Q |
112 |
taacagggaaaaccgccggattggcaagatttcactggtattatggtgttgcttatcattaactcaacgattagtttcattgaggaaaacaatgccggaa |
211 |
Q |
| |
|
||||||||||| || | ||||||||||||||| |||||| | |||||||| ||||| |||||||| |||||||||||||| ||||||||||| || | |
|
|
| T |
48439646 |
taacagggaaagccagcagattggcaagatttcgtaggtattgttgtgttgctcatcatcaactcaaccattagtttcattgaagaaaacaatgcaggca |
48439547 |
T |
|
| Q |
212 |
atgctgcagctgctttgatggccggtcttgcccccaaaaccaaggtaa |
259 |
Q |
| |
|
|||| ||||| ||||| ||||| || ||||| |||||||||||||||| |
|
|
| T |
48439546 |
atgccgcagcagctttaatggctggccttgcacccaaaaccaaggtaa |
48439499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 215
Target Start/End: Original strand, 44529900 - 44529988
Alignment:
| Q |
127 |
ccggattggcaagatttcactggtattatggtgttgcttatcattaactcaacgattagtttcattgaggaaaacaatgccggaaatgc |
215 |
Q |
| |
|
||||||||||||||||| ||| ||||| ||||||||||| || ||||| |||||||||||||| || ||||||||||| ||||| |
|
|
| T |
44529900 |
ccggattggcaagattttgttggcattatcacattgcttatcatcaattcaaccattagtttcattgaagagaacaatgccggtaatgc |
44529988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 258
Target Start/End: Complemental strand, 1499227 - 1499153
Alignment:
| Q |
184 |
agtttcattgaggaaaacaatgccggaaatgctgcagctgctttgatggccggtcttgcccccaaaaccaaggta |
258 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| || |||||| | ||||| ||| | || ||||||||||||||| |
|
|
| T |
1499227 |
agtttcattgaagaaaacaatgccggcaatgccgccgctgctctcatggctggtttagctcccaaaaccaaggta |
1499153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 169 - 251
Target Start/End: Original strand, 50273487 - 50273569
Alignment:
| Q |
169 |
attaactcaacgattagtttcattgaggaaaacaatgccggaaatgctgcagctgctttgatggccggtcttgcccccaaaac |
251 |
Q |
| |
|
||||||||||| || ||||||||||| || || ||||| || |||||||| |||||| | ||||| ||| | ||||||||||| |
|
|
| T |
50273487 |
attaactcaactatcagtttcattgaagagaataatgctggtaatgctgctgctgctctcatggctggtttagcccccaaaac |
50273569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University