View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16990_high_1 (Length: 393)
Name: NF16990_high_1
Description: NF16990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16990_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 1 - 377
Target Start/End: Complemental strand, 469725 - 469352
Alignment:
| Q |
1 |
tacaatttggatggtaccggtgagtggtggtgcagcaacttcaaattcagaaacacagacacaaaacatgtggccttttactcctcctcatgttcagtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |||||| |
|
|
| T |
469725 |
tacaatttggatggtaccggtgagtggtggtgcagcaacttcaaattcagaaacacagacacaaaacatgtggccttttaatcctc---atgtacagtct |
469629 |
T |
 |
| Q |
101 |
caaaatcaaggcaacgctgctgtaactccgtctcagttacatttcatgccaaggttcaatgttccagcttctggtggtgttgaatttcaaggtggacgtg |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
469628 |
caaaatcaaggaaacgctgctgtaactccgtctcagttacatttcatgccaaggttcaatgttccagcttctggtggtgttgaatttcaaggtggacgtg |
469529 |
T |
 |
| Q |
201 |
gtggtttacaattgggctcagcgtaccaaccatcacagcatttgggattggctgtgtctgattccaacttgggtatgtttgctgctcttaatgcttataa |
300 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
469528 |
gtggtttacaattgggttcagcgtatcaaccatcacagcatttgggattggctgtgtctgattccaacatgggtatgtttgctgctcttaatgcttataa |
469429 |
T |
 |
| Q |
301 |
tagagctgctcatttcaatgttaacaactcttctgatcatcatcaacaacagcctcagcctaatgatgagagtggag |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
469428 |
tagagctgctcatttcaatgttaacaactcttctgatcatcatcaacaacagcctcaacctaatgatgagagtggag |
469352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University