View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16990_low_3 (Length: 237)
Name: NF16990_low_3
Description: NF16990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16990_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 33579189 - 33579403
Alignment:
| Q |
1 |
tctcttttcatcactgtcttaccccccaccccagtcagcatcacagtagacatgtttgagagtttgtgaatgatttgctaggatgaagatgtaacccact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33579189 |
tctcttttcatcactgtcttaccccccaccccagtcagcatcacagtagacatgtt-gagagtttgtgaatgatttgctaggatgaagatgtaacccact |
33579287 |
T |
|
| Q |
101 |
caccccaattcagtcattcagaaatagaaaatatcaatattagacttatatgtgaaatagcattataggtatctagccgatgtatgtaaaccactatcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33579288 |
caccccaattcagtcattcagaaatagaaaatatcaat-----acttatatgtgaaatagcattataggtatctagccgatgtatgtaaaccactatcat |
33579382 |
T |
|
| Q |
201 |
ggtaattgacaaattacttta |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33579383 |
ggtaattgacaaattacttta |
33579403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University